Improve Research Reproducibility A Bio-protocol resource
Concise Method
tooltip

Confirmation of IDH mutation by Sanger sequencing

ZH Zoltán Hujber
GP Gábor Petővári
NS Norbert Szoboszlai
TD Titanilla Dankó
NN Noémi Nagy
CK Csilla Kriston
IK Ildikó Krencz
SP Sándor Paku
OO Olivér Ozohanics
LD László Drahos
AJ András Jeney
AS Anna Sebestyén
request Request a Protocol
ask Ask a question
Favorite

Both IDH1 and IDH2 genes were analysed after using routine DNA Isolation kit for Cells and Tissue (Roche), specific amplifications (AmpliTaqGold Master Mix with the appropriate primers - IDH1 exon4 forward: aaaactttgcttctaatttttctcttt; reverse: acatacaagttggaaatttctgg,; IDH2 exon4 forward: tctagactctactgccttcctc; reverse: gtcagtggatcccctctcca – AppliedBiosystems), purification (ExoSAP-IT – Affimetrix) and direct sequencing (25 cycles at 51 °C, BigDye 3Terminator v3.1 Cycle Sequencing Kit in Genetic Analyser 3500 - Applied BioSystem).

Copyright and License information: The Author(s). ©2017
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

0/150

tip Tips for asking effective questions

+ Description

Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.

post Post a Question
0 Q&A