Generation of Tnfrsf9−/− and Cd27−/− Tnfrsf9−/− mice

The Tnfrsf9^−/− mice were generated as illustrated in Extended Data Fig. 5a. gRNAs that flanked exon 2, the first coding exon of Tnfrsf9 and that contains the translation initiation methionine, were identified using Benchling (https://www.benchling.com/crispr/). The following gRNA sequences were used: 5′, tgcatgtgacatttcgccatggg; downstream 5′, gttatcacaggagttctgcacgg. The Genetic Editing and iPS Cell (GEiC) center at Washington University in St. Louis ordered gRNAs from IDT, complexed gRNAs with Cas9 protein, and the reagents were electroporated into CD27 KO embryos that were generated by in vitro fertilization. The resulting pups were screened by PCR followed by Sanger sequencing to identify those that had successfully created a Tnfrsf9 null gene via indel. The resulting founders were outcrossed to Cd27^−/− and WT C57BL/6 J mice to generate Cd27^−/− Tnfrsf9^−/− doubly deficient mice and Tnfrsf9^−/− mice.