Real-time quantitative polymerase chain reaction

We extracted and purified total RNA from blood samples using the NucleoSpin RNA Blood Mini Kit (MACHEREY-NAGEL, Germany) according to the manufacturer’s protocol. Purity and integrity qualified total RNA was transcribed into cDNA using the HiScript II First Strand Synthesis Kit (Vazyme Bio, China). We performed quantitative polymerase chain reaction (qPCR) using SYBR qPCR Master Mix (Vazyme Bio, China). The primer sequence (5′->3′) for GAPDH are forward primer: AGGTCCACCACTGACACGTT; reverse primer: GCCTCAAGATCATCAGCAAT. The primer sequence (5′->3′) for PFKFB2 are forward primer: CCTCAGAAC AGAACAACAACAG; reverse primer: TGAGGTAGCGTG TTAGTTTCTT. Expression levels of PFKFB2 were expressed as fold changes relative to expression levels of GAPDH and were calculated by the 2-ΔΔCt method.