2.7. Direct Sanger sequencing for BRAF

Genomic DNA was extracted from tissue samples using MagMAX™ FFPE DNA/RNA Ultra Kit (Thermo Fisher Scientific, Wilmington, DE, USA) according to the manufacturer's instructions. BRAF exon 15 was amplified by PCR using the forward primer sequence 5’‐TCATAATGCTTGCTCTGATAGGA‐3′ and the reverse primer sequence 5’‐GGCCAAAAATTTAATCAGTGGA‐3′ to yield an amplicon size of 224 bp. The PCR mix contained 1x PCR Buffer for KOD FX Neo, 0.4 mM dNTPs, 0.3 μM primers, 0.5 U KOD FX Neo (TOYOBO, Osaka, Japan), and 1 μl DNA template in a total reaction volume of 25 μl. The PCR cycling conditions were as follows: 94°C for 2 min, 45 cycles of denaturation at 98°C for 10 s, annealing at 60 °C for 30 s, and extension at 68 °C for 30 s with a final extension at 68°C for 7 min. PCR products were loaded on an agarose gel, and the band corresponding to the BRAF exon‐15 fragment was excised from the gel and purified using a QIAGEN QIAquick gel extraction kit (Qiagen, Hilden, Germany). PCR products (20 ng) were used as templates for sequencing. Sequences were outsourced, and the products were analyzed by Fasmac Japan (Kanagawa, Japan).