Fosmid library preparation and DNA cloning

MS Michal Styczynski
AR Agata Rogowska
CN Christine Nyabayo
PD Przemyslaw Decewicz
FR Filip Romaniuk
CP Cezary Pączkowski
AS Anna Szakiel
RS Roderich Suessmuth
LD Lukasz Dziewit
request Request a Protocol
ask Ask a question
Favorite

The ANT_H4 DNA of 30–50 kb was end-repaired to blunt end and cloned into the copy control pMPO579 vector using the CopyControl Fosmid Library Production Kit, according to the manufacturer's protocol [41, 79].

For subcloning, amplification of the relevant DNA region of the previously isolated ANT_H4-derived fosmid was performed by PCR using synthetic oligonucleotide primers, dNTPs and HiFi polymerase (Qiagen; with supplied buffer) in a Mastercycler (Eppendorf). The forward and reverse primers used in this study were 5′CGTACTGCAGGTCGTTACGGTTCATCTTGTG and 5′GACTCTCGAGTGTAATAGGCCGTTACCAGTC, respectively. The PCR product was then analyzed by electrophoresis on 0.8% agarose gel. The confirmed product of 1,689 bp was then digested with XhoI and PstI restriction enzymes and cloned into the multiple cloning site located within the lacZα sequence of pBluescript II SK to facilitate selection by standard blue-white screening. Further transformation into E. coli TG1 was performed according to the Kushner method [62].

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

0/150

tip Tips for asking effective questions

+ Description

Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.

post Post a Question
0 Q&A