Improve Research Reproducibility A Bio-protocol resource
Concise Method
tooltip

Fosmid library preparation and DNA cloning

MS Michal Styczynski
AR Agata Rogowska
CN Christine Nyabayo
PD Przemyslaw Decewicz
FR Filip Romaniuk
CP Cezary Pączkowski
AS Anna Szakiel
RS Roderich Suessmuth
LD Lukasz Dziewit
request Request a Protocol
ask Ask a question
Favorite

The ANT_H4 DNA of 30–50 kb was end-repaired to blunt end and cloned into the copy control pMPO579 vector using the CopyControl Fosmid Library Production Kit, according to the manufacturer's protocol [41, 79].

For subcloning, amplification of the relevant DNA region of the previously isolated ANT_H4-derived fosmid was performed by PCR using synthetic oligonucleotide primers, dNTPs and HiFi polymerase (Qiagen; with supplied buffer) in a Mastercycler (Eppendorf). The forward and reverse primers used in this study were 5′CGTACTGCAGGTCGTTACGGTTCATCTTGTG and 5′GACTCTCGAGTGTAATAGGCCGTTACCAGTC, respectively. The PCR product was then analyzed by electrophoresis on 0.8% agarose gel. The confirmed product of 1,689 bp was then digested with XhoI and PstI restriction enzymes and cloned into the multiple cloning site located within the lacZα sequence of pBluescript II SK to facilitate selection by standard blue-white screening. Further transformation into E. coli TG1 was performed according to the Kushner method [62].

Copyright and License information: The Author(s) ©2022
Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

0/150

tip Tips for asking effective questions

+ Description

Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.

post Post a Question
0 Q&A