Improve Research Reproducibility A Bio-protocol resource
Concise Method
tooltip

Epigenetic editing via CRISPR-dCas9

MW Michelle L. Woods
AW Astrid Weiss
AS Anna M. Sokol
JG Johannes Graumann
TB Thomas Boettger
AR Antje M. Richter
RS Ralph T. Schermuly
RD Reinhard H. Dammann
ask Ask a question
Favorite

CRISPR-Cas9 vector px549 was obtained from Lienhard Schmitz (Giessen, Germany) and adapted for epigenetic editing by inactivation of Cas9 by site-directed mutation (dCas9). AATK guide oligos were cloned into BbsI sites of px549-Cas9 or px549-dCas9. Epigenetic modifier plasmids were ordered from Addgene: pcDNA-dCas9-p300 Core (61357), pdCas9-DNMT3A (100090), Ezh2[SET]-dCas9 (100087). Epigenetic editing of endogenous AATK in HEK293T. Guided oligos for AATK are #1 CACGGCCCCCGGCCCG, #2 TCAGCTCGCACTTCGACCCC, #3 CGGCCGCTGGGTGATGCGGC, #4 ACTGCACCAGCGGAGCCCCG and are positioned relative to TSS at −372 #1, −282 #2, −155 #3, −21 #4. Primers for genomic analysis are listed in Table S1. Sanger sequences are depicted as an original dataset in the supplement.

Copyright and License information: The Author(s) ©2022
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

post Post a Question
0 Q&A