Epigenetic editing via CRISPR-dCas9

MW Michelle L. Woods
AW Astrid Weiss
AS Anna M. Sokol
JG Johannes Graumann
TB Thomas Boettger
AR Antje M. Richter
RS Ralph T. Schermuly
RD Reinhard H. Dammann
ask Ask a question
Favorite

CRISPR-Cas9 vector px549 was obtained from Lienhard Schmitz (Giessen, Germany) and adapted for epigenetic editing by inactivation of Cas9 by site-directed mutation (dCas9). AATK guide oligos were cloned into BbsI sites of px549-Cas9 or px549-dCas9. Epigenetic modifier plasmids were ordered from Addgene: pcDNA-dCas9-p300 Core (61357), pdCas9-DNMT3A (100090), Ezh2[SET]-dCas9 (100087). Epigenetic editing of endogenous AATK in HEK293T. Guided oligos for AATK are #1 CACGGCCCCCGGCCCG, #2 TCAGCTCGCACTTCGACCCC, #3 CGGCCGCTGGGTGATGCGGC, #4 ACTGCACCAGCGGAGCCCCG and are positioned relative to TSS at −372 #1, −282 #2, −155 #3, −21 #4. Primers for genomic analysis are listed in Table S1. Sanger sequences are depicted as an original dataset in the supplement.

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

post Post a Question
0 Q&A