The mRNA was produced in vitro according to the previously described, 15 transcribed using the RNA polymerase T7 on a DNA linearization template with generic 5′‐and 3′‐UTRs and poly‐A tails. The RNA was purified using the Ambion MEGA clear spin columns. Then, Antarctic Phosphatase (New England Biolabs) was introduced for 30 min at 37°C to remove the residual 5′‐phosphates upon initiation of treatment. Spectrophotometers from Thermo Scientific were used to quantify the purity of RNA as well as its concentration. The RNA was purified and resuspended at 1 μg/μl in 10 mM Tris HCl, 1 mM EDTA before use. The N1‐methylpseudouridine replaced uridine in mRNA. GFP and luciferase sequences were used as previously described. 16 The sequence of SDF‐1α modRNA open reading frames is as follows:
ATGAACGCCAAGGTCGTGGTCGTGCTGGTCCTCGTG; CTGACCGCGCTCTGCCTCAGCGACGGGAAGCCCGTC; AGCCTGAGCTACAGATGCCCATGCCGATTCTTCGAA; AGCCATGTTGCCAGAGCCAACGTCAAGCATCTCAAA; ATTCTCAACACTCCAAACTGTGCCCTTCAGATTGTAG; CCCGGCTGAAGAACAACAACAGACAAGTGTGCATTG; ACCCGAAGCTAAAGTGGATTCAGGAGTACCTGGAGA; AAGCTTTAAACAAGTAA
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.