Improve Research Reproducibility A Bio-protocol resource
Concise Method
tooltip

Plasmid constructions

FY Fanghua Ye
WZ Wen Zhang
JD Jiajia Dong
MP Min Peng
CF Chenying Fan
WD Wenjun Deng
HZ Hui Zhang
LY Liangchun Yang
ask Ask a question
Favorite

The human STAT1 coding sequence was cloned using reverse transcription PCR. The sequence of primer, forward: 5’-TTAAGCTTGGTACCGAGCTCGCCACCATGTCTCAGTGGTACG-3’; reverse: 5’-CCCTTGCTCACCATGGATCCGCTTCCCCCTCCTCCTACTGTGTTCATCATACTG

TCGAAT-3’. PCR products were ligated into the pcDNA3.1 vector between the kpnI and BamHI restriction sites using ClonExpress II One Step Cloning Kit (Vazyme, China). Mutations were introduced using Mut Express II Fast Mutagenesis Kit V2 (Vazyme, China) following the manufacturer’s instructions. Flag and GFP were tagged at the C-terminus of the expression plasmid. The constructed plasmids were verified by sequencing.

Copyright and License information:  ©2022 Ye, Zhang, Dong, Peng, Fan, Deng, Zhang and Yang
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

post Post a Question
0 Q&A