Morpholino design and validation

Two evi1 splice morpholino oligonucleotides (MO) and a standard control MO were synthesized by Gene Tools (Gene Tools LLC, OR, USA): (1: CCAAAATAGTGGTGTTCTCACCTCT, 2: TGAAGGGTCTGAGTGACTTACATAT), preventing either splicing of the first or the third exon–intron splice junction. Embryos were injected at the one‐cell stage. About 0.05% of phenol red (Sigma‐Aldrich, St. Louis, MI, USA) was added as an injection tracer. Embryos were raised to appropriate stages and fixed in 4% paraformaldehyde (PFA)/1× phosphate‐buffered saline (PBS) for gene expression analysis. For validation, control‐injected and MO‐injected embryos were collected and mRNA was isolated using the RNeasy Mini Kit (Qiagen, Hilden, Germany). cDNA was synthesized using Transcriptor First Strand cDNA Synthesis Kit (Roche, Basel, Switzerland) according to the manufacturer's protocol. RT–PCR was performed using the following primers to verify splice modification on agarose gels: CAAGAGAGATGGCCAAGGAG, GAGCAGGTCTTTCCTGATGC, ATAGTGCTTGCCGCTGTCAT, TATGAAGGGCTTGACGGAAG.