Improve Research Reproducibility A Bio-protocol resource
Concise Method
tooltip

RNA pull-down down assay

TH Tilman Heise
VK Venkatesh Kota
AB Alexander Brock
AM Amanda B. Morris
RR Reycel M. Rodriguez
AZ Avery W. Zierk
PH Philip H. Howe
GS Gunhild Sommer
request Request a Protocol
ask Ask a question
Favorite

For RNA pull-down assays we followed a protocol provided by Myriam Gorospe (National Institute on Aging) [46]. PCR primer combinations were used to generate templates for in vitro transcription to create biotinylated RNA probes: FL (full length) template = B2P1T7/B2P2as spanning −286 to +3, P1 template = B2P1T7/B2P1as spanning −286 to −126, and P2 template = B2P2T7/B2P2as spanning −125 to +3. Oligonucleotide sequences (T7 promoter sequence is underlined):B2P1T7: 5′-GAATTCAAGCTTAATACGACTCACTATAGGGCATCACAGAGGAAGTAGACG; B2P1as: 5′-GATATCGGATCCACGAGGGGGTGTCTTCAATC; B2P2T7: 5′-GAATTCAAGCTTAATACGACTCACTATAGGGCCAAGAATGCAAAGCACATCC; B2P2as: 5′-GATATCGGATCCCATCCTTCCCAGAGGAAAAGC.

Copyright and License information:  ©2016 Heise et al.
This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

post Post a Question
0 Q&A