RNA m6A immunoprecipitation RT-qPCR

Quantitative real-time PCR was performed to assess relative abundance of m6A RNA in the RIP samples. 300 μg total RNA was adjusted the volume to 1000 μl with 5×IP buffer (50 mM Tris-HCl, 750 mM NaCl and 0.5% (vol/vol) Igepal CA-630) and RNase-free water and incubated with 10 μg m6A antibody (Synaptic Systems, cat. no. 202 003, Goettingen, Germany). The mixture was rotated at 4°C for 2 h, then pre-blocked and washed Dynabead Protein A (Thermo Fisher, 1001D) were added and the mixture rotated for an additional 2 h at 4°C. After washing with IP buffer containing Ribonucleoside vanadyl complexes (RVC, Sigma, R3380-5ML) three times, the m6A IP RNA was eluted with 98 μL elution buffer (20 mM Tris-HCl pH 7.5, 300 mM sodium acetate, 2 mM EDTA, 0.25% SDS). 2 μL of proteinase K (Thermo Fisher, AM2546) was added and the RNA incubated for 1 hour at 37°C with gentle shaking. All samples were precipitated using 3 M sodium acetate (pH 5.2) and 2.5 volumes of 100% ethanol and kept at -80°C overnight. cDNA was synthesized by iScrip cDNA Synthesis Kit (Bio-Rad). qPCR analyses was done with Ultra SYBR Mixture with ROX (CWBIO) on a CFX384 Touch Real-Time PCR Detection System (Bio-Rad). qRT- PCR primers that were used to amplify FLC were: flc_qF: AGCCAAGAAGACCGAACTCA and flc_qR: TTTGTCCAGCAGGTGACATC.