Characteristic of strains

A total of 421 non-repeatable complete and draft genomes of B. anthracis (n = 98), B. cereus (n = 232), B. thuringiensis (n = 64), B. weihenstephanensis (n = 6), B. mycoides (n = 10), B. pseudomycoides (n = 1), B. toyonensis (n = 1), B. cytotoxicus (n = 2), B. manliponensis (n = 1), B. gaemokensis (n = 2), B. bombysepticus (n = 1), B. bingmayongensis (n = 1), B. wiedmannii (n = 1) and Bacillus sp. 7_6_55CFAA_CT2 (n = 1), deposited in the Pathosystems Resource Integration Center (PATRIC) database (https://www.patricbrc.org; status from February, 2016), were used for in silico genomic and proteomic assays (Supplementary Table S1).

All strains were classified into seven phylogenetic groups I–VII, based on data collected in the Bacillus cereus group Typing Database (mlstoslo.uio.no) or using the web-tool (https://www.tools.symprevius.org/Bcereus/)⁵⁵. Strains were also characterized in terms of ST types using MLST 1.8 web-based tool⁵⁶, and categorized into groups based on the similarity in allelic profiles (defined here as the groups sharing at least three of the seven alleles) with eBURST software⁵⁷, and denoted as eBURST groups.

In addition, the bacilli were screened for psychrotolerant signatures in cspA (⁴ACAGTT) and 16S rRNA (¹⁸⁰AATATTTTGAACTGCATAGTTC and ¹⁰⁰⁸TCTAGAGATAGA) genes^4,22. Furthermore, emetic B. cereus strains were identified by searching the cereulide synthetase genes (cesB and cesD). The analyses were performed with the CLC Genomics software (CLC Bio).