The isolate DA7-7 was cultured in ISP 2 broth and genomic DNA was extracted using MN DNA extraction kit (Macherey–Nagel, Germany), and 16S rRNA gene was amplified using thermal cycler with 16S rRNA primers 27f (5′AGTTTGATCCTGGCTCAG3′) and 1492r (5′ACGGCTACCTTGTTACGACTT3′). The amplified product was subjected to agarose gel electrophoresis (1.2%). The PCR product was purified using MN DNA purification kit, and sequenced by Roche GSFLX 454 technology (Macrogen, Republic of Korea). The similarity index was determined using BLASTn, and the sequence was submitted to GenBank under the accession number . Phylogenetic tree was constructed for the isolate DA7-7 and other closely related gene sequences by neighbor-joining method using the software MEGA v6.0 (Tamura et al. KT3652852013).
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.