PCR Amplification

The forward primer WBR11 (GGTAACTTCCAAATTCAGAGAAAC) together with the reverse primer WBR13 (TCTCTAATTTAGAATTAGAAGGAA) amplified a specific DNA fragment encoding gluten (200 bp). These primers were designed based on gluten sequences available from the GenBank-European Laboratory database and according by Olexová et al. [27].

The polymerase chain reaction was performed in a volume of 20 μL containing 1 ng to 10 ng DNA, 0.5 µL each primer (10 pmol/μL concentration), 4.0 μL HOT Firepol^® BlendMaster Mix (SolisBioDyne, Tartu, Estonia). Amplification was performed in a Techne thermocycler (London, UK) with an initial step of 95 °C for 12 min. The initial denaturation was followed by 30 cycles with the following steps: 95 °C/20 s; 52 °C/60 s and 72 °C for 2 min. After 30 cycles, a final extension of 72 °C was followed for 10 min. After amplification, the samples were cooled to 6 °C.

All PCR products were size fractionated on agarose gels (1.5%) and visualized using Nucleic Acid GelRed^® (Biotium Inc., Fremont, CA, USA). PCR products were visualized by UV transillumination using Mini Bis Pro^® (DNR Bio-Imaging Systems Ltd., Neve Yamin, Israel).