Viruses

For AAV constructs using the PRSx8 promoter, the PRSx8 promoter sequence based on Hwang et al.⁴² was de novo synthesized (Life Technologies) and inserted into the pAM AAV genome vector⁴³ upstream from the transgene via KpnI and BamHI restriction sites. The sequence of the synthesized PRSx8 promoter was as follows:

5′-AGCTTCCGCTAGACAAATGTGATTACCCCCGCTAGACAAATGTGATTACCCGCGCTAGACAAATGTGATTACCCCGCTAGACAAATGTGATTACCCCCCGCTAGACAAATGTGATTACCCCCGCTAGACAAATGTGATTACCCGCGCTAGACAAATGTGATTACCCCGCTAGACAAATGTGATTACCCCCGACCAGGGCATAAATGGCCAGGTGGGACCAGAGAGCTCACCCCAGCCGACTCTAG-3’

Optogenetic inhibition was achieved with an AAV (DJ serotype) expressing archaerhodopsin (ArchT)⁷² obtained via Addgene (plasmid #29778).

AAVs were packaged via calcium phosphate transfection of HEK293 cells as detailed in⁷³ and purified using an AAVpro purification kit (Takara Bio).