Improve Research Reproducibility A Bio-protocol resource
Concise Method
tooltip

Growth genes transcription

MA Mohsen Abdel-Tawwab
RK Riad H. Khalil
NY Nehal A. Younis
TS Talal A. M. Abo Selema
AS Adel H. Saad
SE Suzan O. M. El-Werwary
AG Ali H. Gouda
AS Ashraf M. Soliman
SS Sherien H. H. Shady
MM Mohamed N. Monier
ask Ask a question
Favorite

The whole mRNA was obtained from 50 mg of anterior kidney and liver tissues with Trizol (iNtRON Biotechnology, Inc., Korea). Nanodrop (Uv-Vis spectrophotometer Q5000/ Quawell, USA) confirmed the extracted mRNA quality and quantity. Following the manufacturer’s instructions, complementary DNA (cDNA) was synthesized using the SensiFASTTM cDNA synthesis kit (Bioline, United Kingdom). IGF-1 (Insulin-like Growth Factor 1) and GH (Growth Hormone) genes primer sequences were employed and β-actin was tested for gene expression stability using GeNorm software 310 (M score = 0.21) and it was used as a housekeeping gene in the normalization procedure (Table 2). For gene expression, quantitative real-time PCR (qRT-PCR; Stratagene MX3000P) was used to measure gene expression using the SYBR green technique (SensiFast SYBR Lo-Rox kit, Bioline). After confirming that qRT-PCR efficiency was close to 100%, gene expression data were computed following Livak and Schmittgen (2001).

PCR primer sequences, accession numbers of tested genes

F: GGCATTGGTGTGATGTCTTT

R: CATATCCTGTCGGTTTGCTG

F: CGTCTCTTCTCAGCCGAT

R: GCTGGTCCTCCGTCTGC

F: TCCTGCGGAATCCATGAGA

R: GACGTCGCACTTCATGATGCT

Copyright and License information: The Author(s) ©2023
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

post Post a Question
0 Q&A