2.3. DNA Extraction, Amplification (PCR) and Sequencing

Fresh cyanobacterial cultures at the exponential growth phase were harvested by centrifugation (Micro STAR 17R, VWR) at 12.000× g for 5 min and stored at −20 °C. Genomic DNA (gDNA) was extracted using the Purelink Genomic DNA Mini Kit (Invitrogen, San Diego, CA, USA) according to the manufacturer’s instructions for Gram-negative bacteria. The integrity and quality of DNA were checked on 1.0% agarose gel, and gDNA was stored at −20 °C. The 16S rRNA gene was amplified using the primers CYA359F (GGGGAATYTTCCGCAATGGG), CYA781R (GACTACTGGGGTATCTAATCCCATT) [26], 27F1 (5′-AGAGTTTGATCCTGGCTCAG3′) and 1494Rc (5′-TACGGCTAC CTTGTTACGAC-3′) [27]. The PCRs reactions were performed with a Biometra TProfessional gradient thermocycler (Biometra, Göttingen, Germany) in a final volume of 20 μL following the methodologies described previously by Nübel et al. [26] and Neilan et al. [27]. The reaction mixture contained 4 μL 5× Green GoTaq^® Flexi buffer (Promega, Madison, WI, USA), 2 μL MgCl₂ (25 mM), 2 μL of each primer (10 μM), 1 μL of deoxynucleoside triphosphate (dNTP, 10 μM) mix (Promega, Madison, WI, USA), bovine serum albumin (BSA), 0.1 μL of GoTaq^® DNA polymerase (Promega) and 1 μL of template DNA. PCR products were examined by electrophoresis in 1.0% agarose gels stained with SYBR^® Safe DNA Gel Stain (Thermo Fisher Scientific, Carlsbad, CA, USA) and then purified with a NucleoSpin^® Gel and PCR Clean-up Kit (Macherey-Nagel, Düren, Germany) according to the manufacturer’s instructions. The obtained products were sequenced bidirectionally by Sanger sequencing by GATC Biotech (Ebersberg, Germany).

For the obtained sequences with low DNA quality, purified PCR products were cloned into the pCR™2.1-TOPO^® vector (Invitrogen TOPO^® TA Cloning Kit) and then transformed into Escherichia coli OneShot^® TOP10 cells (Invitrogen) following the instructions of the manufacturers. After the white-blue selection on the ampicillin 1.5% agarose plates with Luria Bertani (LB) medium, the colonies were transferred into fresh liquid LB medium with 100 μg ml^–1 of ampicillin and cultured overnight at 37 °C with shaking at 2000 rpm. The Plasmid DNA was isolated using GenElute™ Plasmid Miniprep Kit (Sigma-Aldrich, St. Louis, MO, USA) according to the manufacturer’s instructions. The plasmids were sequenced bidirectionally, using the following primers: 27F1, CYA359F, CYA781R, and 1494Rc, by Sanger sequencing at GATC Biotech (Ebersberg, Germany).