3.4. mRNA splicing analysis

To confirm the predicted splicing defect of the mutated L1CAM mRNA, mRNA splicing analysis was performed using peripheral blood sample of the pregnant woman. After total RNA extraction, RT‐PCR was performed using the HiFiScript cDNA synthesis kit (CWBIO, Beijing, China) according to the manufacturer's instructions. The target regions of the cDNA sequence around the c.3046 + 1G > A mutation of L1CAM (Exons 22–24) were amplified by PCR using 2 × TSINGKE master mix (Tsingke, Beijing). The primer sequences used for PCR were as follows: E22F: 5′—ACAACCTGACCGATCTCAGC—3′ (sense) and E24R: 5′—GGTTGTAGCTGACATACTGTGG—3′ (antisense) (Tsingke, Beijing, China). The PCR products were run on 2% agarose gel electrophoresis and verified by Sanger sequencing.