DNA extraction and microbial community analyses

DNA was extracted from field samples and for samples from incubations or bioreactors. For field samples, 250 mL of the aqueous phase of each sample was centrifuged at 14,000x g for 20 min at 4°C to pellet the cells. For incubations, 5 mL of sample was centrifuged at 14,000x g for 10 min at 4°C. For the bioreactors, 5 mL of the effluent was collected on ice then centrifuged at 14,000x g for 10 min at 4°C. Following completion of the experiment, the bioreactors were dismantled and 5 mL of sterile water was added to 5 g of inlet sand fraction and shaken vigorously. The supernatant was then removed and centrifuged at 14,000x g for 10 min at 4°C to pellet cells. DNA was extracted from the cell pellets using the FastDNA extraction kit for soil (MP Biomedicals). DNA was quantified with a Qubit fluorimeter (Invitrogen) using the Quant-iT double-stranded DNA (dsDNA) HS assay kit (Invitrogen).

For the 2013 field samples 16S rRNA genes were amplified using a two step-PCR procedure. The first PCR (25 cycles) was done using non-barcoded universal 16S primers (926F: AAACTYAAAKGAATTGRCGG and 1392R: ACGGGCGGTGTGTRC) with conditions as described elsewhere (Park et al., 2011). PCR products were checked with gel electrophoresis and purified with a QIAquick PCR Purification Kit (Qiagen). The second PCR (10 cycles) was done using barcoded FLX titanium amplicon primers 454T_RA_X and 454T_FwB, which have the 16S primers (926F and 1392) as their 3'-ends (Park et al., 2011). The resulting PCR products were purified and quantified prior to pyrosequencing at the McGill University Genome Quebec Innovation Centre, Montreal, using a Genome Sequencer FLX instrument and a GS FLX titanium series XLR70 kit (Roche Diagnostic Corporation).

For 2015 field samples, incubation and bioreactor DNAs were amplified using the same two-step PCR process but with Illumina Miseq non-barcoded primers (926Fi5 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGAAACTYAAAKGAATWGRCGG and 1392RiF GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGACGGGCGGTGWGTRC) for the first PCR (25 cycles). For the 2nd PCR (10 cycles), forward primer (P5-S50X-OHAF) with a 29-nt 5' Illumina sequencing adaptor (P5, AATGATACGGCGACCACCGAGATCTACAC), an 8-nt identifying index S50X and a 14-nt forward overhang adaptor (OHAF, TCGTCGGCAGCGTC), and reverse primer (P7-N7XX-OHAF) with a 24-nt 3' Illumina sequencing adaptor (P7, CAAGCAGAAGACGGCATACGAGAT), an 8-nt identifying index N7XX and a 14-nt reverse overhang adaptor (OHAF, GTCTCGTGGGCTCGG), were used. The final PCR product was purified and quantified using the same procedures as above and sent for Illumina Miseq sequencing at the University of Calgary.

Analyses of pyrosequencing and Illumina Miseq sequences were done with the MetaAmp software, (http://ebg.ucalgary.ca/metaamp/; developed by the University of Calgary Energy Bioengineering Group) and sequences were subjected to stringent quality control (QC). Merged reads using PEAR 0.9.8 were uploaded to MetaAmp, which used a cutoff quality score for each sequence of 50 and a minimum length of each sequence of 420 base pairs. The QC sequences were clustered into operational taxonomic units (OTUs) using average neighbor clustering at a distance of 3%. Each remaining OTU was assigned to a taxon by comparing with the latest version of the non-redundant 16S rRNA small subunit SILVA database. Samples were clustered into a dendrogram using the unweighted pair group method algorithm (UPGMA) and the distance between communities was calculated using the Bray-Curtis coefficient in the Mothur software. The dendrogram was visualized using the MEGA5.2.2. Program (Tamura et al., 2011). The entire sets of raw reads have been submitted to the NCBI Sequence Read Archive (SRA) under Bioproject accession number PRJNA181037, with Biosample numbers SAMN06624370 and SAMN06624665.