Generation of mutants and transgenic flies

Drosophila Naa30A deletion was generated by imprecise excision of a P element, inserted in the 5’ UTR of the Drosophila Naa30A gene (CG11412). Briefly, the y¹, P(EPgy2)Naa30A^EY10202,w^67c23 (BL16976) was crossed with PΔ2-399B, Sb/TM3, Ser transposase line. F1 male flies were balanced by crossing them with female virgins Df(1)pn38/FM0. F1 female flies, resulting from this second cross, were chosen as candidate deletions (white eye) and single-female crosses with males Df(1)pn38/FM0 were performed for stock balancing. Deletion sizes were determined by PCR and sequencing, using a forward primer 1 kb upstream (CAAGGAAAGTGGAGGAAGTGC) and a reverse primer 1.5 kb downstream (GGTATGTATCCCTCGCCAATG) of the 5’ end of CG11412. Nearly 100 lines were tested and the y1, Naa30A^Δ74, w^67c23 was selected. Removal of the w recessive marker to create the stock y1, Naa30A^Δ74, was performed by recombination with the wild-type X chromosome from the Oregon-R (OR) strain.

For generation of Drosophila strains carrying a genomic fragment with the Naa30A gene, a fragment containing the genomic sequence of Naa30A franked by 1 kb pairs upstream and downstream of the 5’UTR and 3’UTR was synthesized by Genescript (Piscataway, NJ, USA). This fragment was sequenced and cloned into pCaSpeR2 in the PstI and EcoRI restriction sites to create the pCaSpeR2-gNaa30. Microinjection of pCaSpeR2-gNaa30 and selection of transfected strains was performed by BestGene (Chino Hills, CA, USA).