Improve Research Reproducibility A Bio-protocol resource
- Home
- Protocols
-
Concise Method
Relative mtDNA content measurements
Request a Protocol
Ask a
question
Favorite
The level of mtDNA was measured by assessing the relative levels of mtDNA-ND1 to nDNA-B3M using a PCR analysis of total DNA extracted from human HLE and Huh7 cells. The following amplification primers (5′ to 3′) were described previously [35]: mtDNA-ND1 (sense, CCCTAAAACCCGCCACATCT; antisense, GAGCGATGGTGAGAGCTAAGGT) and nDNA-B3M (sense, TGCTGTCTCCATGTTTGATGTATCT; antisense: TCTCTGCTCCCCACCTCTAAGT).
Copyright and License information: The Author(s) ©2023
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Post a Question0 Q&A
