Total RNA from retinas was isolated using TRIzol reagent (15596018, Invitrogen, Grand Island, NY, USA). RNA (1 μg) was then reversely transcribed into cDNA using SuperScript IV Master Mix with ezDNase (11766050, Thermo Fisher Scientific, Waltham, MA, USA). A qRT-PCR was performed using the Quant Studio 3 (Applied Biosystems, Foster City, CA, USA) system with TaqMan primers (Thermo Fisher Scientific, Waltham, MA, USA). Following is a list of genes with reference numbers from Thermo Fisher Scientific Company: Elovl4-Mm00521704_m1; Acly-Mm01302282_m1; Fasn-Mm00662319_m1; Scd1-Mm00772290_m1; Acc1-Mm01304258_m1; GAPDH-Mm99999915_g1. Lxr beta was purchased from Biorad (Nr1h2-Cat#10031252). The following cycling protocol was used: 95 °C for 20 s, followed by 40 cycles of amplification at 95 °C for 15 s and 60 °C for 60 s.
Sybr green real-time PCR reaction was performed using the next primers: Rxr alpha (forward5′CATTGGGCTTCGGGACTGGT3′, reverse 5′CCTCGTTCTCATTCCGGTCC3′); Rxr beta (fwd5′ATTCCTCCGGGCCTGTCAGCA3′, rev5′CTCCATCCCCGTCTTTGTCC3′); Rxr gamma (fwd5′CAGGTCTGCCTGGGATTGGA3′ REV5′CCTCACTCTCTGCTCGCTCT3′); PPAR alpha (fwd5′AGAAGTTGCAGGAGGGGATT3′, rev5′TTGAAGGAGCTTTGGGAAGA3′); PPAR gamma (fwd5′CCCCTACAGAGTATTACG3′, rev5′TCTCTCCGTAATGGAAGACC3′); GAPDH (fwd5′TGACGTGCCGCCTGGAGAAA3′, rev5′AGTGTAGCCCAAGATGCCCTTCAG3′). PCR cycling program: 95 °C for 2 min 20 s, followed by 40 cycles of amplification at 95 °C for 20 s and 60 °C for 60 s. Relative expression levels of genes were calculated using the ΔΔCt method.
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.