Reverse transcription‑quantitative polymerase chain reaction (RT‑qPCR) analysis

LX Lei Xu
YC Yifei Chen
SF Shoujie Feng
ZL Zeyan Liu
YY Ying Ye
RZ Ranran Zhou
LL Lijun Liu
ask Ask a question
Favorite

Total RNA was isolated from lung tissue with TRIzol reagent. Each 20 µl sample consists of 10 µl SYBR‑Green PCR Master mix (2X), 0.1 µM primers, 100 µg genomic DNA. The samples were amplified by qPCR using a Roche Light Cycler 480 following procedure: 95 °C 10 min, 45 cycles (95 °C 10 s, 60 °C 10 s, 72 °C 20 s), one cycle (95 °C 1 min, 65 °C 1 min, 97 °C continuous), 40 °C 30 s. Primers synthesized by Sangon Biotech (Shanghai, China), PEDF forward, 5'‑CAGAGTCTGTCATTCACCGGGC‑3'; reverse, 5'‑GTCAGCACAGCTTGGATAGTCTTC‑3'. β-actin forward, 5'‑ CTAAGGCCAACCGTGAAAAGA‑3' and reverse, 5'‑ CCAGAGGCATACAGGGACAAC‑3'. The level of PEDF mRNA were quantified through β-actin.

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

post Post a Question
0 Q&A