Macrophage phagocytosis assay

The phagocytic ability of macrophages toward live cancer cells was evaluated by a luminescence-based long-term phagocytosis assay as we previously described⁷¹. Specifically, luciferase-expressing Raji cells (ATCC, Cat# CCL-86) were co-cultured with BMDMs isolated from mouse blood for 24 h in the absence or presence of CD47-blocking antibody (clone B6H12) (BioXCell, Cat# BE0019-1). Thereafter, the luminescence signal was measured by the addition of luciferin and detection with Cytation 3. For evaluating the effects of GPR84 agonists and/or antagonists, BMDMs were pretreated with corresponding chemicals overnight. After a thorough wash with PBS, the pretreated BMDMs were then used for phagocytosis assay. Cancer cells cultured without BMDMs were used as a normalization control for calculation which indicates a phagocytosis rate of 0%. 6-OAU (0.1 μM) was used to stimulate the activity of GPR84, while GLPG1205 (10 μM) or pertussis toxin (0.1 mg/ml) were used to block the stimulative effect of 6-OUA. Mycoplasma examination was performed routinely for Raji cells and the result was negative.

The CRISPR-Cas9 system was used to knockdown the GPR84 expression in primary macrophages. The control sgRNA (AGUCCGGUCGAAAUCUGUAU), sgRNA targeting mouse GPR84 (CGCCAGUUUCGCCACGCGUA) were cloned into LentiCRISPR V2 vector. The plasmids were transfected with the packaging and envelop plasmids into 293 T cells to generate lentiviruses. Forty-eight hours transfection, the viruses were harvested and incubated with 4x Lentivirus Concentrator Solution containing 40% PEG-8000 and 1.2 M NaCl with constant rocking overnight at 4 °C. After incubation, the virus was centrifuged at 1600 × g for 60 min at 4 °C, and thoroughly resuspended with Iscove’s Modified Dulbecco’s Medium (IMDM). Mouse bone marrow cells were collected and cultured in IMDM supplemented with murine MCSF (10 ng/ml) and concentrated lentivirus for a period of 72 h. Subsequently, the cells were cultured in fresh IMDM medium containing murine MCSF for an additional 48–96 h before being utilized for a phagocytosis assay.