Macrophage phagocytosis assay

XZ Xuan Zhang
YW Yujing Wang
SS Shreyas Supekar
XC Xu Cao
JZ Jingkai Zhou
JD Jessica Dang
SC Siqi Chen
LJ Laura Jenkins
SM Sara Marsango
XL Xiu Li
GL Guibing Liu
GM Graeme Milligan
MF Mingye Feng
HF Hao Fan
WG Weimin Gong
CZ Cheng Zhang
request Request a Protocol
ask Ask a question
Favorite

The phagocytic ability of macrophages toward live cancer cells was evaluated by a luminescence-based long-term phagocytosis assay as we previously described71. Specifically, luciferase-expressing Raji cells (ATCC, Cat# CCL-86) were co-cultured with BMDMs isolated from mouse blood for 24 h in the absence or presence of CD47-blocking antibody (clone B6H12) (BioXCell, Cat# BE0019-1). Thereafter, the luminescence signal was measured by the addition of luciferin and detection with Cytation 3. For evaluating the effects of GPR84 agonists and/or antagonists, BMDMs were pretreated with corresponding chemicals overnight. After a thorough wash with PBS, the pretreated BMDMs were then used for phagocytosis assay. Cancer cells cultured without BMDMs were used as a normalization control for calculation which indicates a phagocytosis rate of 0%. 6-OAU (0.1 μM) was used to stimulate the activity of GPR84, while GLPG1205 (10 μM) or pertussis toxin (0.1 mg/ml) were used to block the stimulative effect of 6-OUA. Mycoplasma examination was performed routinely for Raji cells and the result was negative.

The CRISPR-Cas9 system was used to knockdown the GPR84 expression in primary macrophages. The control sgRNA (AGUCCGGUCGAAAUCUGUAU), sgRNA targeting mouse GPR84 (CGCCAGUUUCGCCACGCGUA) were cloned into LentiCRISPR V2 vector. The plasmids were transfected with the packaging and envelop plasmids into 293 T cells to generate lentiviruses. Forty-eight hours transfection, the viruses were harvested and incubated with 4x Lentivirus Concentrator Solution containing 40% PEG-8000 and 1.2 M NaCl with constant rocking overnight at 4 °C. After incubation, the virus was centrifuged at 1600 × g for 60 min at 4 °C, and thoroughly resuspended with Iscove’s Modified Dulbecco’s Medium (IMDM). Mouse bone marrow cells were collected and cultured in IMDM supplemented with murine MCSF (10 ng/ml) and concentrated lentivirus for a period of 72 h. Subsequently, the cells were cultured in fresh IMDM medium containing murine MCSF for an additional 48–96 h before being utilized for a phagocytosis assay.

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

post Post a Question
0 Q&A