In vitro T7 sgRNA transcription.

Transcription templates for sgRNAs were constructed with a 5’ T7 promoter and the CasX2 scaffold sequence followed by the selected 17–23 bp sequence complementary to the target DNA sequence. The template was generated through overlap extension PCR using primers that were purchased from Integrated DNA Technologies (IDT, Coralville, IA). An initial annealing step was performed with a 110 nt forward primer, X2_F_template (5’-GAATTAATACGACTCACTATAGTACTGGCGCTTTTATCTCATTACTTTGAGAGCCATCACCAGCGACTATGTCGTATGGGTAAAGCGCT-3’) containing the sequences for the T7 promoter and tracr region, and a reverse primer, X2_R_template (5’-(17–23 bp gRNA) + CTTTGATGCTTCTTATTTATCGGATTTCTCTCCGATAAATA-3’) containing the variable gRNA, by combining 45 μM of the forward and reverse primers in 1X STE buffer for a total volume of 10 μl, and annealing for 5’ at 95°C followed by slow cooling to room temperature before the addition of 90 μl of nuclease free-H₂O. Post-annealing PCR was performed with the addition of a shorter forward primer (5’-GAAATTAATACGACTCACTATAGTACTGGCGCTTTTATCT-3’) and the X2_R_ Template in 10 μM final concentration with 5 μl polymerase master mix at the following cycling conditions: 98°C/30sec, 25 × (98°C/5sec, 68°C/10sec, 72°C/15sec), 72°C/2min, 4°C. The PCR product was purified with the Qia-quick PCR clean up kit (Qiagen, Germantown, MD). The Hi-Scribe T7 High Yield RNA synthesis kit (NEB) was used to generate RNA transcripts at 37°C for 16 hours, according to the manufacturer’s protocol. The final sgRNA sequence is: 5’-UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUAUGUCGUAUGGGUAAAGCGCUUAUUUAUCGGAGAGAAAUCCGAUAAAUAAGAAGAUCAAAG + (17–23 nt gRNA)-3’. Sequences of the DNA oligonucleotides used for in vitro transcription, as well as the RNA sequences of the resulting 17–23 bp spacers of the sgRNAs are shown in Supplemental Table 1.