Generation of Ad(Spike) vector

The AdSpike construct was developed following a similar protocol as described.⁷¹ Briefly, the Spike gene cassette combined a Kozak sequence with the full length of the Spike protein (Genbank accession number {"type":"entrez-protein","attrs":{"text":"QHU36824.1","term_id":"1805293613","term_text":"QHU36824.1"}}QHU36824.1), codon optimized to mouse and human expression avoiding restriction sites Bgl2, Pac1, and Pme1, followed by a Kpn1 restriction site and the poly-A signal “TCTAGACTCGACCTCTGGCTAATAAAGGAAATTTATTTTCATTGCAATAGTGTGTTGGAATTTTTTGTGTCTCTCACTCGGAAGGACATATGGGAGGGCAAATCATTTGCGGCCGCGATATC” (GenScript, Piscataway, NJ, USA). The gene cassette was flanked by Bgl2 sites and synthesized by Integrated DNA Technologies (Coralville, IA, USA) then cloned into the vector, pShuttle-CMV-Cuo.⁷² Primers to confirm gene sequence can be found in Table S3. The plasmid containing our recombinant non-replicating human adenovirus serotype 5 (E1 and E3 genes removed (ΔE1-, ΔE3-); 1^st generation) encoding the S-protein gene was made through homologous recombination in AdEasier-1 cells (strain), a gift from Dr. Bert Vogelstein (Addgene plasmid #16399) (Addgene, Watertown, MA, USA).⁷³ It was then linearized with PacI and transfected into HEK293A cells (RRID:CVCL_6910). Our recombinant adenovirus was then amplified using SF-BMAd-R cells⁷⁰ in 3 batches (Ad(Spike) 1–3), combined, and purified by ultracentrifugation on CsCl gradients as described previously,⁷⁴ before titration using a TCID₅₀ assay. A second human adenovirus serotype 5 (ΔE1-, ΔE3-; 1^st generation), lacking a gene cassette, was used as a negative control.