All animal experiments in the present study were performed under the guidelines of the Institute of Animal Care and Use Committee of Konkuk University (IACUC# KU21020). The Ino80 cKO allele (Ino802f/2f) and Tg(MMTV-Cre) animals were obtained from the Institut Clinique de la Souris (ICS; llkirch, France) and the Jackson laboratory. Female Ino802f/2f mice were bred with Ino802f/+; MMTV-Cre males to produce littermate control (Ino802f/2f) and experimental (Ino802f/2f; MMTV-Cre) females. PCR genotyping for the Ino80 cKO allele was carried out with the following primers: 5′-AGGCCTTATTTAGCTCAGGTTGGC-3’ (forward) and 5′- CCACTACACACAGCAGATACACAT -3’ (reverse). The PCR amplicons for wildtype and the conditional alleles were 224 and 382 bp, respectively.
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.