Improve Research Reproducibility A Bio-protocol resource
Concise Method
tooltip

Transient gene silencing

KS K. Srivastava
KL K. E. Lines
DJ D. Jach
TC T. Crnogorac-Jurcevic
request Request a Protocol
ask Ask a question
Favorite

Fifty nM siRNA was used to silence S100PBP in cells (Panc1 and MIA PaCa2). Briefly, 0.5 × 106 cells were seeded in tissue culture dishes before treatment with either scram (non-target) or two independent siRNA molecules against human S100PBP (Mol1: AUGGUGGUUCACACAAG UCAA, Mol2: CUGUGUGAGUAAUGCAUUCUA; Qiagen, UK) mixed with RNAiMax transfection reagent (Life Technologies, UK). Fresh medium was replaced after 16 h, and cells were harvested for protein and RNA analysis after 72 h of transfection. A fraction of cells from matching population were cultured on glass coverslips in their respective medium for cellular localisation studies.

Copyright and License information: The Author(s) ©2023
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

post Post a Question
0 Q&A