Single cells RT-PCR assay

The single-cell RT-PCR assay was performed according to a previous study [35]. Briefly, the slices were transferred to the patch-clamp recording chamber and continuously perfused with diethyl pyrocarbonate-treated, DNase- and RNase-free aCSF. GFP + abGCs or GFP- mGCs in the inner granule cell layer were visually identified under an infrared differential interference microscope and fluorescence microscopy. An autoclaved glass pipette was filled with pipette buffer consisting of reverse transcription buffer and then transferred to the headstage on the micromanipulator for patch-clamp recording. Neurons were patched with negative pressure, and their cytoplasm was gently aspirated into the patch pipette. The pipette tip was then broken into a DNase- and RNase-free PCR tube containing reverse transcription components and immediately snap-frozen. A sample of the bath solution from the vicinity of the neuron was collected to replace the cellular template as a negative control. The first-strand cDNA was synthesized using the High Capacity cDNA Reverse Transcription kit (Invitrogen, Carlsbad, CA, United States), and the target genes were detected by quantitative real-time PCR amplification as previously described. The primer sequences were as follows: NR2A: F: CAACGAAGGGATGAATGTGA, R: ACAAAGGGCACGGAGAAGT; NR2B: F: TGCTACAACACCCACGAGAA; R: CTCCTCCAAGGTAAC GATGC. All PCRs were performed following procedures designed to minimize the chances of cross-contamination.