RNA interference and generation of CRISPR KO cell line

Shaifali Singh; Nai Yang Yeat; Ya-Ting Wang; Shu-Yu Lin; I-Ying Kuo; Kuen-Phon Wu; Won-Jing Wang; Wen-Ching Wang; Wu-Chou Su; Yi-Ching Wang; Ruey-Hwa Chen

Improve Research Reproducibility A Bio-protocol resource

Home
Protocols

Concise Method

RNA interference and generation of CRISPR KO cell line

SS Shaifali Singh

NY Nai Yang Yeat

YW Ya-Ting Wang

SL Shu-Yu Lin

IK I-Ying Kuo

KW Kuen-Phon Wu

WW Won-Jing Wang

WW Wen-Ching Wang

WS Wu-Chou Su

YW Yi-Ching Wang

RC Ruey-Hwa Chen

This method is extracted from research article: Cell Death Dis, Oct 2023

PTPN23 ubiquitination by WDR4 suppresses EGFR and c-MET degradation to define a lung cancer therapeutic target

DOI: 10.1038/s41419-023-06201-4

Ask a question

Favorite

Lentivirus-based shRNA constructs were obtained from National C6 RNAi Core Facility (Taipei, Taiwan). The target sequences of various shRNAs are listed in Supplementary Table S4. WDR4 KO cells were generated by National C6 RNAi Core Facility. Briefly, two sgRNAs were designed to target exon 1 and exon 7. The sgRNAs were cloned to pAll-Cas9.Ppuro (National C6 RNAi Core Facility). The targeting sequences for exon 1 are: 5'GTCACCGACCGGTGCGGAC & 5'GCCGCGTCTCTGCGCCTGGA and for exon 7 are: 5'TGTGGGGCTTCCGTCAGGT & 5'GGCAGTCGCCTGACTTGAG. A549 cells were transfected with the generated plasmids, selected with puromycin, and followed by single cell colony isolation. The devoid of WDR4 expression was confirmed by Western blot.

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

Post a Question

0 Q&A

Share your protocol with your peers.

Submit a Preprint Protocol