Improve Research Reproducibility A Bio-protocol resource
Concise Method
tooltip

DNA constructs

HL Huimin Liu
SS Shaoming Sang
YL Yuan Lu
ZW Zhongfeng Wang
XY Xiang Yu
CZ Chunjiu Zhong
request Request a Protocol
ask Ask a question
Favorite

RNAi constructs were designed as oligonucleotides (GenePharma, Shanghai, China) targeting both mouse and rat sequences of the gene of interest, and tested for knockdown efficiency by western blotting. The effective ones were then inserted into pSuper-GFP. Sequences used for morphological analyses include: (1) Tpk1 RNAi-2 sequence: CCTGAAGTCAAAGAGTACTTT for mouse Tpk1 (NM_013861) and rat Tpk1 (NM_001134994) sequences; (2) Slc25a19 RNAi-1 sequence: GGTATGAGCTCTTCTGTAATT for mouse Slc25a19 (NM_026071) and rat Slc25a19 (NM_001007674) sequences; (3) Slc19a3 RNAi-1 sequence: TAACCTGAGCTTAGAACGTTA for mouse Slc19a3 (NM_030556) and rat Slc19a3 (NM_001108228) sequences. The other sequences tested by Western blotting, as shown in Supplementary Figure 1 are: (1) Tpk1 RNAi-1: GAAGGGCTGTGATCTTATTTT; (2) Slc25a19 RNAi-2: GGTACGAGCTCTTCTGTAATT; (3) Slc19a3 RNAi-2: AGCCTACTTTGCCTACATATA.

Full-length mouse sequences (RNAi sensitive) were used to test RNAi efficiency, while the full-length human sequences (RNAi resistant) were used for rescue experiments. All sequences were PCR cloned from cDNA generated using mouse brain tissue or human HEK 293 cells and cloned into pCS2. For mouse Tpk1 (NM_013861) and human TPK1 (NM_022445), a Myc tag (8 repeats) was inserted C-terminal to the coding sequence to generate Tpk1-myc and TPK1-myc respectively. For mouse Slc25a19 (NM_026071) and human SLC25A19 (NM_001126121), an HA tag was added N-terminal to the coding sequence to generate HA-Slc25a19 and HA-SLC25A19. Similarly, for mouse Slc19a3 (NM_030556) and human SLC19A3 (NM_025243), a N-terminal HA tag was added to generate HA-Slc19a3 and HA-SLC19A3.

For measuring TDP level in cultured neurons, the Tpk1 RNAi-2 sequence was inserted into the FUGW lentiviral vector to generate LV-Tpk1 RNAi (Obio Technology, Shanghai, China), which expressed shRNA under the H1 promoter and EGFP under the Ubiquitin promoter.

Copyright and License information: The Author(s) ©2017
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

post Post a Question
0 Q&A