2.3. Viral Propagation and Titer

CG Claudia Gallegos-Rodarte
OE Omar Escobar-Chavarría
MC Meztli Miroslava Cantera-Bravo
RS Rosa Elena Sarmiento-Silva
AB Alejandro Benitez-Guzman
request Request a Protocol
ask Ask a question
Favorite

To propagate and acquire the viral stocks of the NADL cp-BVDV and NY-1 ncp-BVDV strains, we used Madin–Darby Bovine Kidney Cells (MDBK) (ATCC® CCL-22, Manassas, VA, USA). We performed RT-PCR to confirm the absence of the BVDV in the MDBK cells and fetal bovine serum, using the primers FW GCTAGCCATGCCCTTAGTAGGACTAGC and RV AACTCCATGTGCCATGTACAGCAGAG to amplify the 5′ UTR region. The fetal bovine serum was free of BVDV antibodies. The cells were maintained in a DMEM supplemented with 10% fetal bovine serum (FBS) (Gibco, New York, NY, USA) and incubated at 37 °C with 5% CO2. To infect the cells, we changed the medium to a DMEM supplemented with 2% FBS, agitated it for 2 h and then incubated it for 72 h for the NADL cp-BVDV strain and 96 h for the NY-1 ncp-BVDV strain; the cells were lysed through freeze–thawing (3 cycles) to obtain the viral stock for each strain. For the viral titration of the NADL cp-BVDV strain, we cultured MDBK cells on 96-well plates, performing tenfold serial dilutions of the viral inoculum, and the titer was determined with the Reed–Müench Method. For the viral titration of the NY-1 ncp-BVDV strain, we used BT cells (Bos Taurus turbinate, ATCC® CRL-1390, Manassas, VA, USA) cultured with a DMEM supplemented with 10% horse serum on 24-well plates with 12 mm coverslips. The cells were infected with the viral strain, and at 72 h post-infection, they were removed from the medium and fixed on slides with PBS 1X-PFA 4% for 15 h at 4 °C and washed 3 times with PBS 1X. They were then incubated in a blocking buffer (PBS1X/5% serum/0.3% tritonX100) for 1 h at room temperature, after which the blocking buffer was removed and washed and the cells were incubated with anti-BVDV polyclonal antibodies (VMRD® BVDV FITC, Washington, DC, USA) for 16 h at 4 °C. Then, the antibodies were removed, a Vectashield® mounting medium with DAPI (Vector Laboratories, Newark, CA, USA) was added, and the fluorescent foci were counted using a fluorescence microscope (Leica DM1000, Leica, Wetzlar, Germany) to determine the focus-forming units per mL (FFUs/mL).

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

post Post a Question
0 Q&A