Quantitative RT-PCR

AW Antonin Weckel
MD Miqdad O. Dhariwala
KL Kevin Ly
VT Victoria M. Tran
OO Oluwasunmisola T. Ojewumi
JR Julianne B. Riggs
JG Jeanmarie R. Gonzalez
LD Laura R. Dwyer
JO Joy N. Okoro
JL John M. Leech
MB Margot S. Bacino
GC Grace D. Cho
GM Geil Merana
NA Niroshana Anandasabapathy
YK Yosuke Kumamoto
TS Tiffany C. Scharschmidt
request Request a Protocol
ask Ask a question
Favorite

Indicated populations were sorted into RLT Plus lysis buffer (Qiagen) and stored at −80°C, then processed using Allprep DNA/RNA micro kit (Qiagen) per manufacturer’s protocol. For qPCR analyses, RNA was reverse transcribed using SuperScript III cDNA synthesis kit (ThermoFisher) and amplified using Power SYBR Green PCR master mix (ThermoFisher). Aldh1a2 primers: 5′-GACTTGTAGCAGCTGTCTTCACT-3′, forward, and 5′-TCACCCATTTCTCTCCCATTTCC-3′, reverse. Rsp17 gene was used as a housekeeping gene and amplified with the following primers: ATTGAGGTGGATCCCGACAC, forward; TGCCAACTGTAGGCTGAGTG, reverse.

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

post Post a Question
0 Q&A