Indicated populations were sorted into RLT Plus lysis buffer (Qiagen) and stored at −80°C, then processed using Allprep DNA/RNA micro kit (Qiagen) per manufacturer’s protocol. For qPCR analyses, RNA was reverse transcribed using SuperScript III cDNA synthesis kit (ThermoFisher) and amplified using Power SYBR Green PCR master mix (ThermoFisher). Aldh1a2 primers: 5′-GACTTGTAGCAGCTGTCTTCACT-3′, forward, and 5′-TCACCCATTTCTCTCCCATTTCC-3′, reverse. Rsp17 gene was used as a housekeeping gene and amplified with the following primers: ATTGAGGTGGATCCCGACAC, forward; TGCCAACTGTAGGCTGAGTG, reverse.
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.