Plasmids

All plasmids construction was performed by PCR amplification (CloneAmp HiFi PCR Premix) using the appropriate primers followed by In-Fusion HD Cloning system (Takara) into the EcoRI site of the pLVX-puro vector (Clontech) or into the BamHI/NotI site of the pRetroX-Tight-puro vector (Clontech). The original vector of the C-terminally HA-tagged Su9-TEV protease was gifted from Dr. Thomas Langer ³⁶, and sub-cloned into the HindIII-XhoI site of pcDNA3.1 (+) ⁷². The mammalian Tag (−) PINK1 expression vector was gifted from Dr. Noriyuki Matsuda ⁷³. For subcloning of TOM20 (SS)-DELE1 (d101)-HA or TOM20 (SS)-DELE1 (d200)-HA into pLVX-puro vector, the N-terminal 90 bp of human TOMM20 and linker sequence 5’- ggtggatctggaggttctggtgga -3’ were inserted before the DELE1 (d101) or DELE1 (d200)-coding sequence, respectively. For subcloning of PINK1 (MTS)-DELE1 (d101)-HA into pLVX-puro vector, the N-terminal 102 bp of human PINK1 were inserted before the DELE1 (d101)-coding sequence. For replacing the 102–200 region of DELE1 with different length of linkers derived from nucleolin, the nucleotide sequences of human nucleolin coding from V46 to S65 (20 a.a.), to K95 (50 a.a.), or to S145 (100 a.a.) were PCR amplified using the NCL-GFP plasmid ⁷⁴ as a template, and were inserted into pLVX-puro vector together with the PCR fragments covering DELE1 N-terminal (1–101 a.a.) or C-terminal (201–515 a.a.) regions by In-Fusion assembly. All the plasmids used in this study are listed in key resources table.