Generation of stable cell lines

The full‐length and ∆CA Ldh 3′UTR were cloned into the pMT‐luciferase plasmid (de Toeuf et al, ²⁰¹⁸) or a plasmid containing the Luciferase coding sequence under control of the Ldh promoter region and transfected in combination with a neomycin‐resistant plasmid (1/20 ratio). Luc‐CA‐rich 3′UTR reporter gene was obtained by inserting three copies of the Ldh mRNA CA‐rich region (underlined in Fig 2C) downstream of the Firefly Luciferase coding sequence. Cells were selected for at least 3 weeks with neomycin (200 μg/ml). When indicated, cells were induced by CuSO₄ (0.5 mM) for 3 h. eIF4EHP‐ and eIF4E6‐Cas9 and CTRL KO S2 cell lines were generated by transfection of a pAC‐Cas9‐puro plasmid (Bassett et al, ²⁰¹⁴) in which the eIF4EHP (GGAGCTCCCGGTAGGGCTTCAGG), eIF4E6 (GGGGATCCGCCGAACAAGGG) or Yellow (Addgene #49331) guide sequences were inserted. Cells were selected with puromycin (5 μg/ml) for at least 3 weeks. Subcloned cells were selected by limit dilution. All transfections were performed with FuGENE HD according to the manufacturer's instructions (Promega).