FACS and real-time PCR

For motor neuron-specific analysis, thoracic ganglion from flies expressing GFP in all motor neurons (D42-Gal4, UAS-10X-GFP) were removed and dissociated using 1 mg/ml collagenase (Sigma, St. Louis, MO) and sorted from non-fluorescent cells on a Beckman Dickinson Aria FACS unit using a 70 µm tip. Total RNA was extracted by FACS sorting ~50,000 Drosophila neurons into RTL buffer from an RNAEasy kit, and subsequently extracted via the same kit using the standard protocol (Qiagen, Hilden, Germany). First strand cDNA was generated by reverse transcription with SuperScript III enzyme (Invitrogen, Waltham, MA). Quantitative PCR was performed on an ABI 7500 Fast Real-Time PCR system, using exon-spanning primers and SYBR green PCR premix (Applied Biosystems, Warrington, UK). The following primer pairs (Forward/Reverse, 5’-3’) were used for these analyses: 4eBP: CACTCCTGGAGGCACCA/ GAGTTCCCCTCAGCAAGCAA, complexin: CGCGAGAAGATGAGGCAAGA/ CATCAGGGGATTGGGCTCTT, tubulin: ACAACTTCGTGTACGGACAGT/ CACCACCGAGTAGGTGTTCA, syntaxin: CCACAAACGGACGAGAAGACC/ CGCCGACGACTTATTCTGCT, cacophony (cac): TTCGGGCGCACTGCATAAG/ GGTGGCCTTTTCCAGGATGT. Technical replicates were performed in triplicate for all target and control genes. Transcript quantification was performed by the ∆∆Ct method. For 4EBP quantification under diet conditions, the experiment was repeated on biologically independent samples four times.