RNA sample preparation

DW Daria R. Wonderlick
JW Julia R. Widom
MH Michael J. Harms
request Request a Protocol
ask Ask a question
Favorite

We synthesized sequence variants of the Vibrio vulnificus adenine riboswitch aptamer domain by in vitro transcription of the corresponding DNA oligonucleotides (HiScribe T7 High Yield RNA Synthesis Kit, New England Biolabs, Ipswich, Massachusetts; oligonucleotides ordered from Eurofins, Luxembourg). The wild-type RNA sequence is shown with mutated positions in boldface: 3′GGGAAGAUAUAAUCCUAAUGAUAUGGUUUGGGAGUUUCUACCAAGAGCCUUAAACUCUUGAUUAUCUUCCC. The riboswitch product was purified by running the in vitro transcription reaction on a 12% denaturing polyacrylamide gel, identifying the 71-nucleotide product by UV shadowing, and extracting the product from the gel by electroelution. The purified RNA product was concentrated by ethanol precipitation, desalted, quantified by NanoDrop absorbance spectroscopy, and resuspended in 50 mM Tris-HCl before being stored at −80°C until further use.

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

post Post a Question
0 Q&A