Generation of cell tropism restricted H5N1 viruses

Recombinant HPAI H5N1 viruses based on a human isolate (A/Vietnam/1203/2004 strain) were generated using the reverse genetics system [63,64,65]. The NP segments carrying miRNA target sites were generated as previously described [28]. Briefly, four copies of the miRNA target site (Complementary to the mature miRNA sequence) were incorporated into the 3’UTR of the NP gene immediately after the stop codon followed by duplication of the ~200nt NP segment packaging sequence. The Complementary sequences of miR-126-3p (126T; CGCATTATTACTCACGGTACGA), miR-142-3p (142T; TCCATAAAGTAGGAAACACTACA), and scrambled target sequence (ScrbT; GAGAATCTAAACGACTCAATACA) were incorporated into the NP segment. Recombinant H5N1-126T, H5N1-142T, H5N1-DblT and H5N1-ScrbT viruses were rescued as previously described [66]. Briefly, 0.5 μg of each of the eight pDZ plasmids representing the eight segments of the H5N1 genome were transfected into HEK-293T cells using Lipofectamine 2000 (Invitrogen), and was followed by co-culture with MDCK cells. After 48h post-transfection, ~200μl of the supernatants were transferred onto fresh MDCK cells seeded in 6 well plates and monitored for cytopathic effects. Recombinant viruses were plaque purified, propagated in MDCK cells, and the viral stocks were sequenced (Sanger sequencing) and confirmed to be free of unwanted mutations. Low pathogenic H5N1 (A/Vietnam/1203/2004) miR-targeted viruses were generated using an HA gene without the polybasic cleavage site [63].