Genomic engineering

Deletion mutants of meru as well as a N-terminal GFP knock-in were made with the CRISPR/Cas9 system.

To generate deletion mutants of meru gRNA pairs were used (see Figure 1—figure supplement 1A). gRNAs were designed using the Perrimon lab's website (http://www.flyrnai.org/crispr2/). gRNA target sequences (5’−3’): gRNA 1a: CCTCTTAATCGATCTACATACTC, gRNA 1b: CCAACTGTATAGGGGTACCGAAA, gRNA 2a: GGCCCACAGGGGCCGTGAAATGG, gRNA 2b: CCTCTATGGCGTTAATAGCACTG. For the GFP knock-in the gRNA target site was chosen close to the ATG to facilitate the integration of the homologous recombination construct. The gRNA target sequence was CCCAACAACAGAACTCCACATTC. gRNA expression plasmids (pCFD3-dU6:3gRNA, Addgene) for injection into flies were prepared as described in the cloning protocol provided by the Bullock lab's website (http://www.crisprflydesign.org/grna-expression-vectors/). The meru homology region for the GFP knock-in was cloned into the pCR2.1 vector (Life Technologies) using the following primers: CGTTCAAGGATATCTAGTGGCAGG, CGGATTATTGCCGCAGTAGAATCC. To prevent potential cutting of the homologous recombination construct, a silent mutation was introduced at the gRNA target site using the primer CGGTCAATGGAATATGGCGCCACAACAACAGAACTCCACATTC. The eGFP coding sequence was inserted at the meru ATG using overlap extension PCR cloning (Bryksin and Matsumura, 2010). The primers to generate the megaprimer were: GGTTTTTCAAAAGGCGGTCAATGGAATATGGTGAGCAAGGGCGAGGAGC, GGAGTTCTGTTGTTGTGGCGCCATCGTGGACCGGTGCTTGT. Plasmids were confirmed by sequencing and then sent for injections to the Fly Facility (Department of Genetics) at the University of Cambridge. The gRNA expression plasmid pairs for the deletion mutants (250 ng/µL of each plasmid) were injected into embryos of a germline restricted nos-Cas9 line: y¹, M(nos-Cas9.P)ZH-2A, w* (FBst0054591). The gRNA and homologous recombination plasmids were combined at 100 ng/µL and 500 ng/µL respectively.

In the case of the deletion mutants, surviving founders were crossed to a balancer stock (yw;;Dr/TM3). Their progeny were crossed to a meru deficiency line (Df(3L)BSC575/TM6B) to identify mutants by phenotype and genotyped by PCR. Males positive for a deletion were crossed to a balancer stock (w;;TM3/TM6B) to establish stable lines balanced over TM6B. From these lines, DNA was extracted and the meru locus sequenced to characterize the deletion. To obtain a control stock with an identical genetic background (meru control), exactly the same crosses were made, starting with a non-injected male of the nos-Cas9 line. For the GFP knock-in, founders were crossed to a balancer stock (w;;TM3/TM6B). Male progeny were crossed to the same balancer stock and genotyped by PCR. The progeny of single males positive for the knock-in were then used to establish stable lines balanced over TM6B.