RNA was extracted from the CSFV C-strain vaccine (TechBank Biotech, Nanjing, China). A pair of primers, E2F: GTCGACGCCACCATGGCATCAACCATTGCATTCCT (containing SalI site and kozak sequence) and E2R: GGATCCTTATTAACCAGCGGCGAGTTGTT (containing stop codon and BamHI site), were used for CSFV E2 gene amplification. The 1,218 bp RT-PCR products were cloned into the SalI/BamHI sites of the pUSG11/P28 vector (19), generating the recombinant plasmid pUSG11/P28-E2. The recombinant SPV, rSPV-E2, was constructed by homologous recombination of wild-type SPV with pUSG11/P28-E2 as previously described (20). The expression of glycoprotein E2 was analyzed by Western blot and indirect immunofluorescence as previously described (20). Briefly, PK15 cells grown on a 12-well plate were infected with the wtSPV or recombinant virus rSPV-E2 (15 PFU per well). At 72 h postinfection, cells were washed twice in PBS and fixed with cold methanol for 10 min at −20°C. Cells were then washed three times with PBST and blocked by the addition of 10% BSA in PBST. Preparations were incubated for 1 h at 37°C with the monoclonal antibody against E2 (Abnova) in dilution buffer (1% BSA in PBST). After three washes with PBST, cells were treated with the rhodamine conjugated secondary antibody (goat anti-mouse IgG-R, Cwbio) 1:5,000 dilution with PBS for 30 min at 37°C. After a final wash with PBS, all wells were examined using fluorescence microscopy (Zeiss, Germany).
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.