Construction and Identification of rSPV-E2

RNA was extracted from the CSFV C-strain vaccine (TechBank Biotech, Nanjing, China). A pair of primers, E2F: GTCGACGCCACCATGGCATCAACCATTGCATTCCT (containing SalI site and kozak sequence) and E2R: GGATCCTTATTAACCAGCGGCGAGTTGTT (containing stop codon and BamHI site), were used for CSFV E2 gene amplification. The 1,218 bp RT-PCR products were cloned into the SalI/BamHI sites of the pUSG11/P28 vector (19), generating the recombinant plasmid pUSG11/P28-E2. The recombinant SPV, rSPV-E2, was constructed by homologous recombination of wild-type SPV with pUSG11/P28-E2 as previously described (20). The expression of glycoprotein E2 was analyzed by Western blot and indirect immunofluorescence as previously described (20). Briefly, PK15 cells grown on a 12-well plate were infected with the wtSPV or recombinant virus rSPV-E2 (15 PFU per well). At 72 h postinfection, cells were washed twice in PBS and fixed with cold methanol for 10 min at −20°C. Cells were then washed three times with PBST and blocked by the addition of 10% BSA in PBST. Preparations were incubated for 1 h at 37°C with the monoclonal antibody against E2 (Abnova) in dilution buffer (1% BSA in PBST). After three washes with PBST, cells were treated with the rhodamine conjugated secondary antibody (goat anti-mouse IgG-R, Cwbio) 1:5,000 dilution with PBS for 30 min at 37°C. After a final wash with PBS, all wells were examined using fluorescence microscopy (Zeiss, Germany).