NPFR3XHA

NPFR^3XHA was constructed using a CRISPR/Cas9 mediated homologous recombination method. Cas9 targeting site (GACTACCCTGTGCTTTAccg) was selected near the stop codon of NPFR to induce double strand breaks (DSBs).

To obtain guide RNA vector (NPFR-gRNA), one pair of primers with targeting site was synthesized: NPFR-gRNA-F: gtcgGACTACCCTGTGCTTTACCG

NPFR-gRNA-R: aaacCGGTAAAGCACAGGGTAGTC

After annealing, guide RNA was subcloned into single guide RNA (sgRNA) vector (modified PMD18T, a kind gift from Haiyang Chen’s lab), which was digested using BbsI (NEB, Cat# R3535S), by T4 DNA Ligase (NEB, Cat# M0202S). To assemble the sgRNA into the PCR8 vector, one pair of primers with adaptor sequences:

BsaI-U6-F: ATGCGGTCTCCTGACGCTCACCTGTGATTGCTC

BsaI-SgRNA-R: ATGCGGTCTCGGAGTAAAAAAAGCACCGACTCGGTGC was used to amplify the guide RNA. The PCR product and PCR8 vector was digested using BsaI (NEB, Cat# R0535V). The digestion products were assembled through the T4 DNA Ligase. The sgRNA (PCR8-NPFR-gRNA) was then exchanged to the pUAST-attB vector through attP/attB recombination (Invitrogen Gateway® LR Clonase® Enzyme Mix, Cat# 11791019) to obtain the pUAST-attB-NPFR-gRNA.

To induce homolog based integration and the plasmid cutting by the Cas9 vector, a NPFR-Hom-3XHA plasmid carrying a 3XHA at the C-terminal of NPFR with two flanked homolog arms ( ~ 0.9 k and ~1.7 k respectively) was constructed as follows: the homolog arms were amplified (TOYOBO, Cat# KOD-211) from the fly genome

(primer pairs sequences:

NPFR-5′_F:GTGATCGTGTACCCCACGC NPFR-5′_R:CCGCGGCATCAGCTTGGT

NPFR-3′_F:AGCACAGGGTAGTCCTAAGG NPFR-3′_R:AAGTTAAGTGTTCGGCGGGT)and sub-cloned into pEASY-Blunt (TransGen Biotech, Cat# CB111-01). Then, three pairs of primers with a linker sequence were used to amplify

the N terminal homolog arm:

NPFR-5′-1_F:gccagtgccaagcttgcatgcGTGATCGTGTACCCCACGCG

NPFR-5′-1_R:aggaacatcgtatgggtaCCGCGGCATCAGCTTGGT

3XHA tag:

HA-5′_F:ggTACCCATACGATGTTCCTGACTATG

HA-5′_R:taggactaccctgtgctTCACGTGGACCGGTGTCCG and the C terminal homolog arm:

NPFR-3′-1_F:tgaAGCACAGGGTAGTCCTAAGGTCC

NPFR-3′-1_R:tacgaattcgagctcggtaccAAGTTAAGTGTTCGGCGGGTC.

The three segments were assembled into the NPFR-Homo plasmid by replacing the sequences between SphI (NEB, Cat# R3182V) and KpnI (NEB, Cat# R3142S) sites on modified PMD18T plasmid using the multi-site clone Kit (Vazyme, Cat# C113-02). All the constructs were verified by sequencing.

The pUAST-attB-NPFR-gRNA was integrated into the 51D site by microinjection (performed by Unihuaii. Ltd) to obtain the NPFR-gRNA transgenic fly. The NPFR-gRNA transgenic fly was crossed with yw; nos-Cas9 (II-attP40) to induce DSBs. The F1 embryos with DSBs were injected with NPFR-Hom-3XHA plasmid. After eclosion, they were single crossed with yw122; If/CyO; MKRS/TM6B flies of the opposite sex. The F2 male flies were single crossed with yw122; If/CyO; MKRS/TM6B, and the recombination events were verified with PCR (NPFR-seq-F: GCCGCGGTACCCATACGATG, NPFR-seq-R: CGAGCTCTTAGTCGCGTGTG, 997 bp) and immunostaining of HA. The efficiency of the recombination was about 6.5% (3/46).