Experimental model and subject details

Csf1r-Cre mice¹⁰ (C57BL/6-Tg(Csf1r-cre)1Mnz/J, Stock #: 029206) were purchased from the Jackson Laboratory while the Zeb1-floxed mice were kindly provided by Dr. Susan Kaech at Yale University School of Medicine. The Zeb1^f/f;Csf1r-Cre⁺ (Zeb1 conditional knockout or cKO in Csf1r⁺ cells) and their Cre⁻ control (Ctrl) mice were created by breeding Csf1-Cre mice with and backcrossing to the Zeb1-floxed mice. Tail tips of 1–2 weeks old pups are collected for genomic DNA isolation. PCR genotyping for Zeb1 loxP site is performed with the pair of primers: Zeb1-loxP F 5′- CCTGTAACCATAACTGGGTTAGAA and Zeb1-loxP R 5'- CAAACAGTGTGAAGCCAGAGG to identify the wt locus of 206-bp and the loxP locus of 240-bp. The floxed Zeb1 exon 6 was excised by the Cre recombinase activity and was detected by PCR genotyping with cultured Zeb1^f/f;Csf1r-Cre⁺ bone marrow-derived cells (BMCs) using the primers: Zeb1 exon 6 F 5′- CCGCTGGATGGAGTTAAAAA and Zeb1 exon 6 R 5′- TGATGTGCAGCTTCTGGAAC. The Cre gene is identified by the primer pair of Cre F 5′- GCACTGATTTCGACCAGGTT and Cre R 5′- GCTAACCAGCGTTTTCGTTC.