Genome editing of zebrafish il1r1 using CRISPR/Cas9

To rescue the Il-1β induced phenotypes in the CNS/Il-1β model, we performed genome editing of il1r1 using a CRISPR/Cas9 strategy that utilized the crRNA:tracrRNA duplex format with recombinant S. Pyogenes Cas9 nuclease (Cas9) from Integrated DNA Technologies (IDT). Two CRISPR guide RNAs (crRNAs; cr1 and cr2) targeting the il1r1 gene were previously designed as described by Sebo et al.⁵⁸ The crRNA sequences are cr1, 5’-/AltR1/ucgacugcuggacaccagacguuuuagagcuaugcu/AltR2/-3’and cr2, 5’-/AltR1/uuaagguggagcuggucuuaguuuuagagcuaugcu/AltR2/-3’ against exon 8 and exon 9, respectively. CRISPR/Cas9 ribonucleoprotein (RNP) were prepared and microinjected into single-cell embryos according to the IDT demonstrated protocol “Zebrafish embryo microinjection” modified from Dr. Jeffrey Essner (Iowa State University) and as previously described. The embryos were treated with Dox and selected for no inflammation-related phenotypes. Those appearing healthy were raised to adulthood. To confirm the CRISPR-mediated deletion in both copies of il1r1, offspring were genotyped by extracting genomic DNA from individual embryos and performing PCR with il1r1-specific primers: forward primer 5’-tatgtgttcctcttgcagCG-3’ and reverse primer 5’-tgtttatacgagcacCTGTGG-3’ located at the intron 7/exon8 splice-acceptor site and the intron 9/exon 9 splice acceptor site, respectively (lower case denotes intron sequence and upper case denotes exon sequence).

The same cr1/cr2 RNP complexes were used to generate il1r1-/- crispants. Combined cr1/cr2 (1:1) RNP complexes were microinjected into CNS/Il-1β single-cell embryos and imaged by confocal microscopy at about 52-54 hpf to examine CtA formation using kdrl:EGFP and transcriptional activation of the glut1b using the transgenic line glut1b:mCherry.