5. Determination of mitochondrial to nuclear DNA ratio (mtDNA/nDNA ratio) in urine by quantitative real-time PCR

After discarding the intact cells and cellular debris, supernatants were harvested and stored at −80℃. Total DNA was isolated and purified from urine samples (3.5 mL) using column-based DNA Extraction commercial Kit (SinaPure, Sinaclon, Iran). The extraction was conducted according to the manufacturer’s protocol. Each DNA concentration was measured by NanoDrop spectrophotometer. To identify the mtDNA/nDNA ratio as mitochondria-specific cellular damage, qPCR was performed (LightCycler^® 96 System, Roche, Switzerland) to amplify conserved single-copy genes encoded in the mitochondrial genome and nuclear genome, with SYBR^® Green as a fluorescent dye (Pishgam, Iran). The expression of mtDNA was normalized by that of nuclear DNA using the relative cycle threshold (ΔCt) method. The qPCR reaction (10 µL) contained 0.5 µmol/L of each primer and 10 ng of DNA. The mitochondrially encoded NADH dehydrogenase 1 ({"type":"entrez-nucleotide","attrs":{"text":"NC_012920","term_id":"251831106","term_text":"NC_012920"}}NC_012920) was amplified as for the mtDNA, using forward 5′CCACTTTCCACACAGACATCA3′ and reverse 5′GGTTAGGCTGGTGTTAGGG3′ primers (product size=127 bp) and human beta-2-microglobulin ({"type":"entrez-nucleotide","attrs":{"text":"M17987","term_id":"179316","term_text":"M17987"}}M17987) as for the nDNA (forward 5′TGCTGTCTCCATGTTTGATGTATCT′3 and reverse 5′TCTCTGCTCCCCACCTCTAAG′3, product size=86 bp). The following reaction conditions were used: 15 min at 95℃; and 40 cycles of 95℃ for 30 s, 60℃ for 30 s and 72℃ for 30 s. The assays were performed in duplicate for each DNA sample and negative controls without a template were run for each gene. The means of the cycle threshold values for mtDNA and nDNA were used to calculate delta Ct (ΔCt) for each sample and 2^−ΔCT was used for statistical analysis.27,28 The efficiency of the assay for amplifying both nDNA and mtDNA was measured with standard curves generated by a dilution series of 10.00, 1.00, 0.10 and 0.01 ng of total genomic DNA. Negative controls without templates were run for each gene.