Mouse models

ApoL6 transgenic mice: Two strains of ApoL6 overexpressing mice were generated, Myc-tagged ApoL6 driven by −5.4 kb aP2 (FABP4) promoter (aP2-ApoL6 TG) and HA-tagged ApoL6 driven by the −5.2 kb adiponectin promoter (adipoQ-ApoL6 TG). Mice were genotyped using their tails. Positive mice were mated with C57BL/6 J mice (The Jackson Laboratory) and both lines were germline transmitted. All transgenic mice and littermates were on C57BL/6 J background. aP2-ApoL6 TG genotype primers were forward 5′-AAACCCAACAGAGCTTGCAG-3′ and reverse 5′-CAAGTCCTCTTCAGAAATGAG-3′. adipoQ-ApoL6 TG genotype primers were forward 5′- TGTCAATTTCAGGGCTCAGGATA-3′ and 5′-GCTTTCGTCAATGTGGTCTGC-3′.

Global ApoL6 knockout mice (ApoL6 KO) were generated by using the CRISPR-Cas9 system, gRNA targeting translation start site (TCTGTCTGATGGCTCGGGGTTGG) and Cas9 mRNA were injected into the zygotes. By sequencing the ApoL6 genomic region of KO cells, we verified one KO line with a 11 bp deletion in the coding region of the third exon (18 bp after translation start site) and the line was germline transmitted (Fig. 2a upper). Transgenic and knockout mice were generated by the UC Berkeley Gene Targeting Facility. Primers for wild type were forward 5′- AAACTCCAACCCCGAGCCAT-3′ and reverse 5′- GCCCCAATTAAACGCTTTCC-3′; ApoL6 KO mutant primers were forward 5′- GGTGCAAACTCCATCAGA-3′ and reverse 5′- GCCCCAATTAAACGCTTTCC-3′.

We provided either a standard chow diet (Harlan Teklad LM-485) or a high-fat diet (HFD; 45% of calories from fat, 35% of calories from carbohydrates, and 20% of calories from protein; Research Diets) ad libitum after weaning. For fasting/feeding experiments, mice were fasted overnight and then fed a high carbohydrate, fat-free diet (70 kcal% carbohydrates, Research Diets) for 8–16 h. The light was turned on at 7 a.m. and off at 7 p.m. Animal housing and all protocols and experimental procedures were approved by the University of California at Berkeley Animal Care and Use Committee.