Validation of variation in the diagnostic marker

The base variation of SNP A09_114690064 was confirmed by PCR amplification and sequencing. The specific primers were designed upstream and downstream of the locus were: ahFAD2A-F: CATTGCACAAGGCAACCGAA, ahFAD2A-R: CGAACGGCTATGAAACCAGC. The cis-acting regulatory DNA elements was analyzed using http://www.dna.affrc.go.jp/PLACE/. The KASP marker was developed using the flanking 100 bp sequences of the SNP variant [33]. Two allele-specific forward primers and one common reverse primer were designed and synthesized. The KASP primers were as following. Primer_Allele X: GTAAAATAAATAGTTCCAGTTTAACTTAAGC, Primer_Allele Y: GTAAAATAAATAGTTCCAGTTTAACTTAAGT, Primer_Common: CCAAGAGTCTCTAAAAATAGTGCTAGCAT. Sequences of the KASP primers do not include the tail sequences that interact with the fluor-labelled oligos in the KASP reaction.