16S and ITS amplicon sequencing and data analysis

Amplicon sequencing and bioinformatic and statistical analyses of sequencing data were done following the methods of De Vries et al.⁶⁰ DNA was extracted from 0.16 g of soil using the MoBIO PowerSoil-htp 96-Well DNA Isolation kit (Carlsbad, CA, USA) according to the manufacturer’s protocols and the DNA quality was checked by agarose gel electrophoresis. Bacterial 16S rRNA sequencing followed the dual indexing protocol of Kozich et al.⁶¹ for the MiSeq plaform (Illumina, San Diego, CA, USA). Each primer consisted of the appropriate Illumina adaptor, 8-nt index sequence, a 10-nt pad sequence, a 2-nt linker, and the amplicon specific primer. The V3–V4 hypervariable regions of the bacterial 16S rRNA gene were amplified using primers 341 F⁶² and 806 R⁶³, CCTACGGGAGGCAGCAG, and GCTATTGGAGCTGGAATTAC, respectively. Amplicons were generated using high-fidelity DNA polymerase Q5 Taq (M0491L, New England Biolabs, Ipswich, USA), premixed dNTPs (BIO-39053, Meridian Bioscience, Ohio, US), and using Eppedorf Mastercycler Nexus PCR machines (Hamburg, Germany). After an initial denaturation at 95 °C for 2 min, PCR conditions were: denaturation at 95 °C for 15 s, annealing at 55 °C for 30 s with extension at 72 °C for 30 s, repeated for 30 cycles, followed by a final extension of 10 min at 72 °C.

Fungal internal transcribed spacer (ITS) amplicon sequences were generated using a 2-step amplification approach. Primers GTGARTCATCGAATCTTTG and TCCTCCGCTTATTGATATGC⁶⁴ were each modified at the 5’ end with the addition of Illumina pre-adaptor and Nextera sequencing primer sequences. After an initial denaturation at 95 °C for 2 min, PCR conditions were: denaturation at 95 °C for 15 s, annealing at 52 °C for 30 s with extension at 72 °C for 30 s, repeated for 25 cycles, with a final extension of 10 min at 72 °C included. PCR products were cleaned using a DNA Clean-up Kit (ZR-96, Zymo Research Inc., Irvine, US) following manufacturer’s instructions. MiSeq adaptors AATGATACGGCGACCACCGAGATCTACAC and 8nt dual-indexing barcode sequences were added during a second step of PCR amplification. After an initial denaturation 95 °C for 2 min, PCR conditions were: denaturation at 95 °C for 15 s; annealing at 55 °C for 30 s with extension at 72 °C for 30 s; repeated for 8 cycles with a final extension of 10 min at 72 °C.

Amplicon concentrations were normalized using SequalPrep Normalization Plate Kit (A10510-01, Thermo Fisher Scientific, Waltham, US) and amplicon sizes determined using an 2200 TapeStation (Agilent, Santa Clara, US) prior to sequencing each amplicon library separately using MiSeq (Illumina, San Diego, US) with V3 600 cycle reagents (MS-102-3003, Illumina, San Diego, US) at concentrations of 14 and 7 pM (16S and ITS respectively) with a 5% PhiX control v3 (FC-110-3001, Illumina, San Diego, US) library.

Sequenced paired-end reads were joined using PEAR⁶⁵, quality filtered using FASTX tools (hannonlab.cshl.edu), and length-filtered to a minimum length of 300 bp. The presence of PhiX and adaptors were checked for and removed with BBTools (jgi.doe.gov/data-and- tools/bbtools/), and chimeras were identified and removed with VSEARCH_UCHIME_REF⁶⁶ using Greengenes Release 13_5 (at 97%). Singletons were removed and the resulting sequences were clustered into operational taxonomic units (OTUs) with VSEARCH_CLUSTER⁶⁶ at 97% sequence identity. Representative sequences for each OTU were taxonomically assigned by RDP Classifier with the bootstrap threshold of 0.8 or greater using the Greengenes Release 13_5 (full) as the reference. Unless stated otherwise, default parameters were used for all steps listed. The fungal ITS sequences were analysed using PIPITS⁶⁷ with default parameters. Briefly, this involved quality filtering and 97% clustering of the ITS2 region as indicated above for the 16S processing, using the UNITE database for chimera removal and taxonomic identification of representative OTUs. Both bacterial and fungal OTU abundance tables were rarified to a minimum of 9000 reads per sample, and samples with zero reads were removed prior to further analyses.

Plots showing circular representations of the taxonomic trees were created using the GraPhlAn software tool (https://huttenhower.sph.harvard.edu/graphlan/).