Vector construction

The CaMV 35S promoter (35SP) controlling expression of the hygromycin B phosphotransferase (hph) selection gene in pCAMBIA1300 was replaced with the nopaline synthase gene promoter (nosP). The nosP and hph genes were amplified by PCR and fused using overlapping PCR with the following primer pairs; hph‐F (5′‐TCTCCGCTCATGATCATGAAAAAGCCTGAACTCACCGCGA‐3′) and hph‐R (5′‐CTCGAGCTTGTCGATCGACAGATCCGGTCGGCATC‐3′), and nosP‐F (5′‐GAATTCTCTAGACACGTGAGATCCGGTGCAGATTATTTGGATTGAGAGTG‐3′) and nosP‐R (5′‐TTCAGGCTTTTTCATGATCATGAGCGGAGAATTAAGGGAG‐3′). The resulting nosP‐hph fusion was ligated into pCAMBIA1300 using XhoI and EcoRI restriction sites. An INPACT expression cassette encoding the GUS reporter gene was excised from pINPACT‐GUS (Dugdale et al., 2013) and ligated into the above vector using EcoRI/HindIII restriction sites. The nearly complete INPACT cassette encoding hVN (with native secretion signal, KDEL retention signal and polyhistidine affinity tag) was then excised from pINPACT‐hVN (Dugdale et al., 2013) and ligated into the vector using SwaI/PacI restriction sites to create pINPACT‐hVN‐nos. Wild‐type TBSV p19 (GenBank Accession {"type":"entrez-nucleotide","attrs":{"text":"M21958.1","term_id":"335172","term_text":"M21958.1"}}M21958.1) was codon modified to include human and N. tabacum first preferred codons and an 84‐bp synthetic intron (syntron; Dugdale et al., 2013) between the AG/GT at nucleotide position 201. The modified p19 gene was chemically synthesized by GeneArt^® (Life Technologies, Mount Waverley, VIC, Australia) and ligated upstream of the nopaline synthase gene terminator (nosT) in the plasmid pACN2 using unique PstI restriction sites. The final INPACT hVN expression vector was constructed by three‐way ligation of the following fragments: Pmll/XbaI digested pINPACT‐hVN‐nos backbone, PmlI/BamHI digested alcA promoter sequence and BamHI/XbaI digested p19‐nosT sequence from pACN2. The resulting vector was designated pINPACT‐hVN2 (Figure 1).

Construction of the vector pAlc‐Rep/RepA, a pBIN‐based vector backbone containing (i) the TYDV Rep/RepA activator genes downstream of the alcA promoter, (ii) the alcR transcription factor gene under the transcriptional control of 35SP and (iii) the neomycin phosphotransferase (nptII) resistance gene for kanamycin selection of transformed plant cells, has been previously described (Figure 1; Dugdale et al., 2013).