4.8. Vector Production and Virus Titration

LV particles were produced by polyethylenimine (PEI) (408727, Sigma-Aldrich, St. Louis, MO, USA), as previously described [69]. Briefly, for second-generation LVs, 293T packaging cells were transfected with packaging plasmid pCMvdR8.91, plasmid pMD2.G.47 encoding the vesicular stomatitis virus (VsV-g) envelope gene (http://www.addgene.org/Didier_Trono/, accessed on 2 June 2020) and the desired vector plasmid (SG, SIFLG, SIFG or S2G). The producer cells were cultured for 24, 48 and 72 h and the viral supernatants were collected and filtered through 0.45 μm filters (Nalgene, Rochester, NY, USA). The viral particles were then concentrated by ultracentrifugation in a Beckman Optima Centrifuge (Beckman Coulter, CA, USA) at 40,000 rpm for 2 h at 4 °C, and the viral pellets were resuspended in StemSpan medium (StemCell Technologies, Vancouver, Canada) for 1 h on ice, aliquoted, and immediately frozen at −80 °C.

Viral titres (transduction units [TU]/mL) were calculated using quantitative PCR. Briefly, 10⁵ K562 cells were transduced with serially diluted amounts of LV. Genomic DNA was isolated (10⁵ cells, equivalent to 0.6 μg of genomic DNA) (kit QiAamp DNA Mini Kit) (Qiagen) and the copy number of LVs integrated was measured using a standard curve (from 10⁵ to 10 copies) of plasmid DNA. We used KAPA SYBR FAST Universal qPCR (KAPA Biosystems) in a Mx3005P QPCR System from Stratagene (Agilent Technologies, Santa Clara, CA, USA). The primers used for titration were ∆U3 (fw: GACGGTACAGGCCAGACAA) and PBS (rev: TGGTGCAAATGAGTTTTCCA).