Protein engineering and expression

Six generations of directed evolution were undertaken to improve the soluble expression of E. coli-expressed wildtype EST6. The method followed Jackson et al.²¹, but in this case the coding region of Est6 from the iso-1 y¹cn¹bw¹sp¹ reference strain (http://flybase.org/reports/FBsn0000272.html), omitting the 63 bp encoding the N-terminal signal peptide³³, was cloned into the expression vector pETMCSIII⁶⁶ between the NdeI and EcoRI sites in frame with the ATG start codon of the NdeI site. Adequate expression of Est6 could be achieved by ‘leaky expression’ because of the presence of trace amounts of lactose in the LB media used. The error-prone PCR protocol used to construct the initial mutant library involved a reaction mixture comprising 100–200 ng of pETMCSIII-Est6, 1 μM primers pET3 and pET4 (5′CGACTCACTATAGGGAGACCACCAC3′ and 5′CCTTTCGGGCTTTGTTAGCAG3′), 1 × Taq DNA polymerase buffer, 5 mM MgCl₂, 0.1–0.4 mM MnCl₂, 0.5 mM dNTPs, 5U Taq DNA polymerase, and milliQ H₂O to a final volume of 50 μl. Thermocycling involved 30 cycles of 94 °C for 10 s, 45 °C for 10 s and 30 s at 72 °C. The NdeI- and EcoRI-digested PCR product was gel extracted, ligated back into pETMCSIII, and then used to transform competent BL21 (DE3) star cells. Transformed cells were plated onto LB plates containing 100 mg. l⁻¹ ampicillin. After incubation at 30 °C overnight, the colonies were blotted onto 3 M filter papers and esterase activity was assayed by staining the filter paper with a solution consisting of 10 ml of 0.1% w/v Fast Red and 0.2 ml of 1% w/v 2 NA in 0.1 M Tris pH 7.0. Between 200–300 (approximately 1%) of the colonies generating the most intense red colour were then picked by hand and grown overnight in 500 μl of LB, 100 mg. l⁻¹ ampicillin, in 96-well culture plates. 50 μl of each of these cultures was then added to the corresponding well of a 96-well assay plate that contained 250 μl of a reaction mixture consisting of 0.5 mM 2 NA, 0.5 mM Fast Red, and 0.1 M Tris pH 7.0. The reaction was monitored with a spectrophotometer at 490 nm, and the 10–20 colonies generating the highest activities were sequenced and used as parents for the next generation of mutation and selection. The protocols for generations 2 to 6 followed those above. The sixth generation mutant generating the highest activity in the spectrophotometric assay, denoted EST6-1, was used for crystallization.